                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCGCCTTGGCTATGGGGCCGGGCATTACGACCGCGCATTGGCGCGCTTTGCGGAGC
GTGGATTGCAGCCGCTTCTGATCGGCATGGCCTTCGACTGCCAGGAAGTGGATTATGT
TCCAAATGAGCCGCATGACATCGCGCTTCACCAGATCCTGACCGAGAGCGGCCTGCGC
TCGCGCGCAATGGACTGAccgctcgggttttatcctgcatttatgtgaccgtcaggcgatgccgcctgactgcaaaatgccccgagc
ggcttgcgttcgcttggcactggcgtataaggcggtctcATG

    BMEI0316 Gene: BMEI0316     GI: 17986599     BI number: BMEI0316     GOG: COG1692     Description: hypothetical protei AT A  G A  A C  G C  C T  C TG         T GC       A  C TA        GC        CG AT        AT       T  C TG        CG        CG TA       C  A       GC |  C      A  C       CG |  A      C  C       GC AT        TG        TA GC        TA       |  A |  G       CG       |  T GC       G  A       CG TG        CG        CG GC        GC       |  A AT        CG       |  C AT        TG       |  T GC       A  C      |  G G  A      C  C      |  A A  C      A  |       Gc C  |      G  |       Gc C  |      T  |       Cg GC        AT        Gc TA        CG        At CG        GC        Gc                         gggttttatcctgcatttatgtgaccgtcaggcgatgccgcctgactgcaaaatgccccgagcggcttgcgttcgcttggcactggcgtataaggcggtctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1692 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................