                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:70 nt.    Distance to gene:25 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:40 nt. Size=45 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:    Distance from promoter:9 nt.    Size=52 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtta-tatagg. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgttattggcgcccacctgatgtataggctcgccaatccttttggaagccgttgcctgtcggtaatgggtcttcatatctgccattgggcgaaagtgcc
gcagtttcgataatcaaagctgcgcttttctccccagactttcaggattgagaagATG

    BMEI0322 Gene: BMEI0322     GI: 17986605     BI number: BMEI0322     GOG: COG0254     Description: LSU ribosomal protein L31 gt t  c cg cg gt ta ta        aa gt       g  a cg        cg cg        gt |  g      |  g |  t       gc |  c       gc |  t      t  | |  t      t  | |  c      a  | |  a      c  | |  t       cg |  a       gc         a |  t       ta       t  a gc        cg        at at       t  t       gc a  g      a  t      c  a gc       t  t       ta gc       a  c       ta ta        cg        tg t  t       ta        gc t  t      t  t       at tg       c  a       cg cg        ta        gc cg        gt        cg                         cttttctccccagactttcaggattgagaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0254 Ribosomal protein L31 ... can be seen here     ..................................................................................................................