                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-11.36 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCGCGCTCCTGAAGACACTCAAGAAGCCGATCTGAtttcttgcccagcatgattgatgatttcagcgcatt
gccccggcagtgcgctgaaatatttttgccttcattttttcatatccaaacgattccgcttcatgaatttatgaagtaggctccagagcggttcctattt
ggacagaatcgccggaaccgctctatttctttgttttatcgcattttccaacgcaaaaccgtttcacacttttgcaggaaatgctccagttcaaacaccc
gaccacggagcgcaacacatgagcgatATG

    BMEI0325 --- BMEI0324 Gene: BMEI0325     GI: 17986608     BI number: BMEI0325     GOG: NOG05054     Description: MotA/TolQ/ExbB proton channel family Gene: BMEI0324     GI: 17986607     BI number: BMEI0324     GOG: COG1360     Description: CHEMOTAXIS MOTB PROTEI a  t gt ta at cg ta ta cg gt c  | c  | t  | t  | a  | g  | c  | a  | a  | a  | c  | c  | t  | a  | t  | a  | c  | t  | t  | t  | t  | t  | t  | a  | c  | t  | ta                   a cg                 g  c cg                 g  a gc                  tg t  t                 ta t  c                 ta t  |                 at t  |                |  c t  |                |  g a  |       tt       |  c t  |      g  c      t  c a  |      g  c       cg a  |      c  t       cg a  |      g  a       ta gc        at        ta ta        gt        gc cg        at        gc g  a       cg        cg cg        cg        gc gc        ta        at                         ctatttctttgttttatcgcattttccaacgcaaaaccgtttcacacttttgcaggaaatgctccagttcaaacacccgaccacggagcgcaacacatgagcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG1360 Flagellar motor protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_melitensis_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:201 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-25.10 kcal/mol                                                                         Nomenclature/Definitions CGGCGCGCTCCTGAAGACACTCAAGAAGCCGATCTGAtttcttgcccagcatgattgatgatttcagcgcatt gccccggcagtgcgctgaaatatttttgccttcattttttcatatccaaacgattccgcttcatgaatttatgaagtaggctccagagcggttcctattt ggacagaatcgccggaaccgctctatttctttgttttatcgcattttccaacgcaaaaccgtttcacacttttgcaggaaatgctccagttcaaacaccc gaccacggagcgcaacacatgagcgatATG     BMEI0325 --- BMEI0324 Gene: BMEI0325     GI: 17986608     BI number: BMEI0325     GOG: NOG05054     Description: MotA/TolQ/ExbB proton channel family Gene: BMEI0324     GI: 17986607     BI number: BMEI0324     GOG: COG1360     Description: CHEMOTAXIS MOTB PROTEI           cc          c  g           cg           gc           ta           tg           at           cg           gc           cg           gc           at           cg           ta           ta           ta           at             atttttgccttcattttttcatatccaaacgattccgcttcatgaatttatgaagtaggctccagagcggttcctatttggacagaatcgccggaaccgctctatttctttgttttatcgcattttccaacgcaaaaccgtttcacacttttgcaggaaatgctccagttcaaacacccgaccacggagcgcaacacatgagcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG1360 Flagellar motor protein ... can be seen here     ..................................................................................................................