                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:199 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-15.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-20.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCCTGCTCTTTATGAGGGTGGAAAACTTGCCTTCGTTCCATTCCTGCCCGGAGCGG
AATGGCCGCAAGGGGTTCATATCGAACGACATTTTGCGATTTTTGATCATGTCCTGCC
CGGCCATGATTTTGCGCTTGCACAGGCTGTGGAGGCGCGCCTTGGTCGCGCTTGCGCC
GAAATATCCTAAtttttgtaaaccagagcgcgaagaatcgcggatgcagggacgaacgcgccttggcaacgccttccttcgatcctatgtt
aggccgaaacatcgttccgcggtcgcggaatggacGTG

    BMEI0343 Gene: BMEI0343     GI: 17986626     BI number: BMEI0343     GOG: COG0465     Description: CELL DIVISION PROTEIN FTS CC G  T T  T        G GC       C  G cG       C  A |  T       CG aT        GC         A gC       T  |      T  T gC        CG       A  C tA        CG        CG aT        TA        TA aT        TA        TA gC        AT        GC gC        CG       |  G c  |       CG       |  A gT       T  C      |  C cG       T  |      G  A t  |       GC        GT gC        CG        GT gC       |  C       AT c  |       TA        AT gC        TA        CG cG        CG        GC cG        CG        CG                         ATTTTTGATCATGTCCTGCCCGGCCATGATTTTGCGCTTGCACAGGCTGTGGAGGCGCGCCTTGGTCGCGCTTGCGCCGAAATATCCTAAtttttgtaaaccagagcgcgaagaatcgcggatgcagggacgaacgcgccttggcaacgccttccttcgatcctatgttaggccgaaacatcgttccgcggtcgcggaatggacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0465 ATP-dependent Zn proteases ... can be seen here     ..................................................................................................................