                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-18.50 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGCAAGCGCAAGGGCAGCGAACCCGGTGGCGAACCCGGCATGGAGCCGAAACCGCA
GCCGCAATAAgctgtttaaaatatcgccaagaaagccgggctggtcccggctttcttgctgtccggctttgtatgggcatacagcaaaggctc
gttaaggatttcggcgcatcatactgcatgagcttacgactttgaacgtgggaatgctgaacctgccgccaaaggcgaaattgcatttgcgggggttttc
gcgttattaacggtaaaaaattgctattcgaatatgcgagtggcggcatGTG

    BMEI0344 Gene: BMEI0344     GI: 17986627     BI number: BMEI0344     GOG: COG1109     Description: PHOSPHOGLUCOSAMINE MUTASE / PHOSPHOACETYLGLUCOSAMINE MUTASE / PHOSPHOMANNOMUTAS            AA           C  T           G  A           C  A            Cg            Gc            At            Cg            Gt           |  t           C  t           C  a           A  a           A  a           A  a   G       G  t T  G      C  a A  A      C  t CG       G  c GC       A  g GC        Gc CG        Gc C  A       Ta C  A      |  a A  A      |  g A  C      |  a        g GC       |  a      t  g CG       A  a      c  t GC        Cg        gc G  A       Gc        gc TG        Gc        gc GC        Cg        cg GC        Cg        cg CG        Cg        gc                         tttcttgctgtccggctttgtatgggcatacagcaaaggctcgttaaggatttcggcgcatcatactgcatgagcttacgactttgaacgtgggaatgctgaacctgccgccaaaggcgaaattgcatttgcgggggttttcgcgttattaacggtaaaaaattgctattcgaatatgcgagtggcggcatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1109 Phosphomannomutase ... can be seen here     ..................................................................................................................