                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-13.60 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGCTGGCTATGACAAGGGCCTGAATATCCATGATATTCGCGTGGGGCTACGTTACA
TGTTCGGCGGCTCCGACAACGCTGCTTATGCATCGCAGGCGGCTTCGACAATCGTGGA
CTAAacagggccgcttcgttcggttctcaagggcccggtagaccgggcattttttgttgccttgcggcatatcctctcaaatttcttgcgggcaact
tcaaatattttcattttaaaaggccggattgggttaaagagcggattaagctattaaacattgcgcgcgttttgaaaggggagggacATG

    BMEI0346 Gene: BMEI0346     GI: 17986629     BI number: BMEI0346     GOG: COG0385     Description: SODIUM/BILE ACID COTRANSPORTER HOMOLOG, SBF FAMIL             c           t  g AT       t  t A  C      c  t CG        gc AT        cg G  G       cg CG        gt TA        gt |  C       gc |  T       at |  A      c  c |  A      a  a |  a      A  a |  c      A  g |  a       Tg |  g       Cg Tg       A  |       ag Cg        Gc       t  a Gc        Gc        gc Gc       T  |       gc Cg        Gc        cg Gc        Cg        cg Gt        Tg        cg At        At        gc                         attttttgttgccttgcggcatatcctctcaaatttcttgcgggcaacttcaaatattttcattttaaaaggccggattgggttaaagagcggattaagctattaaacattgcgcgcgttttgaaaggggagggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0385 Predicted Na+-dependent transporter ... can be seen here     ..................................................................................................................