                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgggagtatttccaATGACGACACGCATTACCCGCCTGTTTACCGCCCACCCCCAGTCGGTTGA
CGAGACCTATTTCGAGCATATGGCCTTTGCGGGAAAGTTTTCCCTCAAGCTTTTTGGG
GCGGCCTTTGCGGCGCTGATCCATGCAATTTTGCCATTTTTGTTCGAGAAGACGGCAA
GCACTATCGTTCGCCAGCTATATGAGCGGACGCATAATAGGGGCCGCTGAggccgcttggcgc
gcgaaaattcatgaattttgaatgatttgtccggcataatcggtccggcaagtcatcTTG

    BMEI0355 Gene: BMEI0355     GI: 17986638     BI number: BMEI0355     GOG: COG0121     Description: Glutamine amidotransferases class-I   G G  C T  C       GT A  T      A  T T  T       AT AT        AT CG        GC GC        GC A  G       GC G  G      C  T CG        GC TA        TA TA        TA TA        TG             CTTTTTGGGGCGGCCTTTGCGGCGCTGATCCATGCAATTTTGCCATTTTTGTTCGAGAAGACGGCAAGCACTATCGTTCGCCAGCTATATGAGCGGACGCATAATAGGGGCCGCTGAggccgcttggcgcgcgaaaattcatgaattttgaatgatttgtccggcataatcggtccggcaagtcatcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0121 Predicted glutamine amidotransferase ... can be seen here     ..................................................................................................................