                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAACGCGCCAAGATAAGTGAAACAGCCCGCGGCGCGGGCGGGTTCGGTTCCACCGGCA
CAGCCTGAggcctatgccccaccagatgagaaaagcccggcccatgcgccgggcttttctctatgataaatatttaagatgaaattccgagccc
ggaagcatagataaccggaacatgcaaatgacgattgctgcgatccggcttagaccctacttatgcggtggtgaatgcattatcgcttgggggcaagttt
ctggaaaacgcgcaaagcgcggttttctgaaggttcaggggttttaggGTG

    BMEI0359 --- BMEI0360 --- BMEI0361 --- BMEI0362 Gene: BMEI0359     GI: 17986642     BI number: BMEI0359     GOG: COG0845     Description: periplasmic component of efflux system Gene: BMEI0360     GI: 17986643     BI number: BMEI0360     GOG: COG0577,COG1136     Description: ABC TRANSPORTER ATP-BINDING PROTEIN / ABC TRANSPORTER PERMEASE PROTEIN Gene: BMEI0361     GI: 17986644     BI number: BMEI0361     GOG: COG0577     Description: ABC TRANSPORTER ATP-BINDING PROTEIN / ABC TRANSPORTER PERMEASE PROTEIN Gene: BMEI0362     GI: 17986645     BI number: BMEI0362     GOG: COG3698     Description: hypothetical protei            ta           c  t            cg            gc            gc           |  c           |  c           |  a           A  c            Gc            Ta            Cg           |  a           |  t           |  g   C       |  a A  A      |  g CG       |  a GC       |  a GC       |  a       at C  |      |  a      c  g C  |       Cg       c  c AT        Gc        cg CG       A  c       gc C  A      C  c       gc T  g      A  g       cg Tg        Cg        cg Gc        Gc        cg Gc        Gc        gc                         ttttctctatgataaatatttaagatgaaattccgagcccggaagcatagataaccggaacatgcaaatgacgattgctgcgatccggcttagaccctacttatgcggtggtgaatgcattatcgcttgggggcaagtttctggaaaacgcgcaaagcgcggttttctgaaggttcaggggttttaggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here [S] COG3698 Predicted periplasmic protein ... can be seen here     ..................................................................................................................