                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-21.80 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgcagcgcgcacagccatggcgggcaacgacgatcccctgcctgtcaaaccccggactttgaaacctgctcatttcggcctggccttcattatacttgc
cagcgccgcctatctgctgctgggctgagcagcgctttcagcagcatattcgtgccctcaccgttacgtgagacatattgtagccgcaaaaataacaccg
gctatagagggaacggatgcggataagcgccgttcttttcttgaaagagttgcaaacagaacaggaaatgttctcgcttgagtgacagacaggagctttc
ATG

    BMEI0366 --- BMEI0367 Gene: BMEI0366     GI: 17986649     BI number: BMEI0366     GOG: NOG08818     Description: Hypothetical Protein Gene: BMEI0367     GI: 17986650     BI number: BMEI0367     GOG: NOG08818     Description: Hypothetical Protei            at           a  a           a  a           a  c           a  a           c  c            gc            cg            cg            gc            at            ta            gt            ta           t  |           a  |           t  |           a  |           c  |           a  |           g  | tt       a  | g  a      g  | c  c      t  | cg       g  | at       c  | cg       a  | ta       t  | cg       t  | c  a      g  | c  |      c  | gc       c  | ta       a  |       at gt        cg       g  a |  a       ta       g  a c  t       cg        cg t  t       cg        gc tg        cg        tg at       g  a      a  | ta        ta        gc a  |       gc        gc cg        cg        cg gc        tg        at a  c       ta        at cg        at        gc gc        tg        gt                         tttcttgaaagagttgcaaacagaacaggaaatgttctcgcttgagtgacagacaggagctttcATG     ..................................................................................................................