                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCATTTCCGGAGCGCCTGCTGACGGGCGAGCGGCCCGAGCCGACATTTCTCGTCACC
AAGCCGTTCAACCCCGACATGGTGAAGGCCCTCATCAGCCAGGCACTTTTCTTTGAGG
AAGCATCGCAAGTTGCTGCCTGAcgctggcaggcagcacaacacaggcagccttctttttaaattttaaagcatatgctttgt
aataatcagggctttcaatttgcacaaaaaaaggaacaaattgtttgctaccagcgttatcccttcacatgctgaagaggagaacaactatgctttatta
tGTG

    BMEI0373 Gene: BMEI0373     GI: 17986656     BI number: BMEI0373     GOG: COG5487     Description: Hypothetical Protei                       a                     c  g                     g  g                      gc                      ta                      cg                      gc                     |  a CA                 |  c G  A                |  a C  G                |  a T  T        c       c  c AT       A  g      A  a CG       G  c       Gc GC       T  t       Ta AT        Cg        Cg A  G       Cg        Cg GC        Gc        Gc GC        Ta        Ta AT        Cg        Cg                         ccttctttttaaattttaaagcatatgctttgtaataatcagggctttcaatttgcacaaaaaaaggaacaaattgtttgctaccagcgttatcccttcacatgctgaagaggagaacaactatgctttattatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5487 Small integral membrane protein ... can be seen here     ..................................................................................................................