                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccctccccctcatcctgaggaggtgaactgagcgcagcgaaggaaaccgtctcgaagggctgagggggcatgagcgacgcggcggcaatcctcataaccg
ggaaccgctcttttgggaatatcgtgcgtttccctcagcccttcgaggcttcgctccgcacctcagggtgagggaaagaatacacttgccaaatggatgc
aatttgttgacggcgggagaaatccccgccgttttcttttacatcgtggatcaacaggactattccgttaaaacctatcgctaccgacaaggcccctgaa
ATG

    BMEI0379 Gene: BMEI0379     GI: 17986662     BI number: BMEI0379     GOG: COG1247     Description: PHOSPHINOTHRICIN N-ACETYLTRANSFERAS ca t  g cg cg at cg |  a        c g  g      g  a cg        ta cg        at ta        gt c  a      g  t       aa g  a      t  g      g  a cg        at        at ta        at        gc ta       |  g      |  c |  t      |  a       gc |  a      a  c       gc c  c       cg        cg g  a       cg        gc gc        gc        gc at        tg        cg gt        tg        at cg        cg        gt                         ttcttttacatcgtggatcaacaggactattccgttaaaacctatcgctaccgacaaggcccctgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1247 Sortase and related acyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_melitensis_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.70 kcal/mol Antiterminator: Size=26 nt.     Delta G= -5.40 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-13.99 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ccctccccctcatcctgaggaggtgaactgagcgcagcgaaggaaaccgtctcgaagggctgagggggcatgagcgacgcggcggcaatcctcataaccg ggaaccgctcttttgggaatatcgtgcgtttccctcagcccttcgaggcttcgctccgcacctcagggtgagggaaagaatacacttgccaaatggatgc aatttgttgacggcgggagaaatccccgccgttttcttttacatcgtggatcaacaggactattccgttaaaacctatcgctaccgacaaggcccctgaa ATG     BMEI0379 Gene: BMEI0379     GI: 17986662     BI number: BMEI0379     GOG: COG1247     Description: PHOSPHINOTHRICIN N-ACETYLTRANSFERAS gg a  g a  c gt cg ta cg tg g  g cg cg |  c |  a                  a a  t       gc       t  a a  g      g  g      a  c a  a       cg       c  c g  g       gc        tg g  c      |  a       cg a  g      c  a       cg a  a       at        ta gc        gc       a  a cg       c  |      a  | gc        gc       c  | a  g       at        gc cg        gc        gc gc        ta        cg cg        at        gc                         tcttttgggaatatcgtgcgtttccctcagcccttcgaggcttcgctccgcacctcagggtgagggaaagaatacacttgccaaatggatgcaatttgttgacggcgggagaaatccccgccgttttcttttacatcgtggatcaacaggactattccgttaaaacctatcgctaccgacaaggcccctgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1247 Sortase and related acyltransferases ... can be seen here     ..................................................................................................................