                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=3 nt.   Size=20 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=73 nt.     Delta G=-20.99 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGCGATATTCGCCAAAATGTTCCGACTGGCGGCGCACCGGGGTTTCCCATCTTAGC
CCAAGCCAGTGGAGATCGTCGTAAATCCCTTGTTCCAGTGCCGGTGTGCAGCGCGCGG
TATCGATATCTTCCATGCGGAGCAGGAAGCGTCCGCCGCTTTGTTCGGCCATGTTCGC
ATTCAAAAGCGCGGAATAGGCATGGCCCAGATGGAGCTGGCCATTGGGACTTGGAGCA
AAGCGGAAAACAGGTACGGTCATtgcgggttcaatgtcagttgaatgtcatttgattccattggtacgTTG

    BMEI0382 Gene: BMEI0382     GI: 17986665     BI number: BMEI0382     GOG: COG0122     Description: DNA-3-METHYLADENINE GLYCOSIDAS   C G  A T  G GC TG GC |  G GC CG CG GT TA GT A  | C  | C  | T  | T  | G  | T  | T  | C  | C  | C  | T  | A  | A  | A  | T  | GC CG TA GT C  | TA AT GC                   G |  T                G  A AT         G       A  A GC       G  A       CG GC        CG        GC TA        GC       |  G GT        TA        AT |  G      A  |       GC A  C       CG        GC CG        CG        CG CG        TA        GC                         CGCTTTGTTCGGCCATGTTCGCATTCAAAAGCGCGGAATAGGCATGGCCCAGATGGAGCTGGCCATTGGGACTTGGAGCAAAGCGGAAAACAGGTACGGTCATtgcgggttcaatgtcagttgaatgtcatttgattccattggtacgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0122 3-methyladenine DNA glycosylase/8-oxoguanine DNA glycosylase ... can be seen here     ..................................................................................................................