                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -4.36 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGTGCGATCCGGGTCAGCGAAGCGCTGGAATATGGCATGGTCGGCCACAATACCGGC
CTCATCTCCAATGAAGTCGCACCCTTTGGCGGCGTAAAGCAGTCTGGCCTCGGCCGCG
AAGGCTCCAAATATGGTATCGAGGAATATCTCGAAACCAAATATATCTGTAGCGCCTA
TAAGCGGGGAGCCAAAAAATAGttagaaattgaatgaaggacggcgcattgtttgcgccgccttttctatttatatacataata
ccccctatcccggcaccttgccataaacaacccggaagtttcATG

    BMEI0385 Gene: BMEI0385     GI: 17986668     BI number: BMEI0385     GOG: COG1238     Description: Putative membrane-associated alkaline phosphatas            aa           a  t           g  t           a  g            ta            ta            Gt           A  g           T  a           A  a           A  g           A  g           A  a        g           A  c      t  t           A  |      t  t   A        Cg        at A  G       Cg        cg T  C       Gc        gc A  G      A  g       cg TG       G  c       gc CG       G  a       gc CG        Gt        cg G  A       Gt       a  | CG        Cg        gc GC        Gt        gc                         ttttctatttatatacataataccccctatcccggcaccttgccataaacaacccggaagtttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1238 Predicted membrane protein ... can be seen here     ..................................................................................................................