                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:4 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctctgtctaagagccaacgtcaaaatgtcaggaacgagcgacactttacagggagattatgcattcggtggtgtgggagcgtTGGTAGCGGAG
GAGGGATTCGAACCCCCGACACAAGGATTATGATTCCTCTGCTCTAACCTACTGAGCT
ACTCCGCCacgcgtcgctttacagagacaaattcatcatcgccaatcggcgtacaaatcgttgttcctgcaaggaatggcggcggtatatgtgc
ggaacgagaccctgtcaagcgttcttcgcataggtttcatcttgttttctatcatTTG

    BMEI0420 Gene: BMEI0420     GI: 17986703     BI number: BMEI0420     GOG: COG0673     Description: OXIDOREDUCTAS   g c  g g  a ta gc tg a  a t  g a  |        c ta       t  t gc       t  t gc        gc c  |       cg gc        gc gt       a  | cg       a  | gt       c  | gc        ta ta        gt |  a       ta |  g      c  | |  c       cg a  g       cg at        at gt        gt gc        at at        gc             atcttgttttctatcatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here     ..................................................................................................................