Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-19.80 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATTGACGGTGGAGGAATTCCTTTCCTGGCAATCCTCAATCGATGAGCATGGTCTCGC
CGGCCTGAGGACCACCAGAATCCAGCAATATCGGCACTAGactatttcaagtgcaggccggttttgcagg
gataataagacaagacagataaagcatatcccgctcttggggatcgccgccaacccttattgaccgcggcgcgctttggaaaattgaaaaccggcccctc
ggggccggtttttgtttgcacattgtctgcttatgctatgaattgaaatagcgctttattcaggaggatggcATG

    BMEI0426


Gene: BMEI0426     GI: 17986709     BI number: BMEI0426     GOG: COG2388     Description: ACETYLTRANSFERAS


 ct        aa
c  t      a  t
c  a      a  t
 at       g  g       tc
 at       g  a      c  g
 cg        ta        cg
|  a       ta        cg
|  c       ta        cg
|  c      c  c       gc
 cg        gc        gc
 gc        cg        cg
 cg       g  |       cg
 cg        cg        at
 gc        gc        at
 cg        gc        at
                        ttgtttgcacattgtctgcttatgctatgaattgaaatagcgctttattcaggaggatggcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG2388 Predicted acetyltransferase ... can be seen here

    ..................................................................................................................