                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCATTTATGCTGGGCTATGGGCGCGCCAATCCGGCGGTTTTCTGGGGCAAGACGCG
AAAAACTGAaaagtttggggtttggggcctattcccgcccgggttcgcgcgcagccgcaaaatgcatccacaaaatagcctgcgacatcgtgcc
gtcataagggcttagcgtctggacaagcgttttttacacgcctaaaccggatagtgaaatggagggaatttcgtcctgtgagcacttgcgggataatttt
tggcaggtgcaaaagagggcgaggggagagttcaattgaacatgcaggTTG

    BMEI0473 --- BMEI0474 Gene: BMEI0473     GI: 17986756     BI number: BMEI0473     GOG: COG0723     Description: UBIQUINOL-CYTOCHROME C REDUCTASE IRON-SULFUR SUBUNIT Gene: BMEI0474     GI: 17986757     BI number: BMEI0474     GOG: COG1290     Description: CYTOCHROME             g   t       a  g t  t      g  g t  a      g  a t  c       ta ta        at gc        at cg        at gc        gc |  c      t  | a  t      g  | a  a      a  | c  a       tg a  a       at gc        gc        ca gc        gc       g  c tg       c  t       at cg        cg        gt ta        at        tg gt       a  g       gc c  a      a  a       tg g  g      t  |       cg at       c  |       cg tg        cg        ta ta        gc        gt                         aatttttggcaggtgcaaaagagggcgaggggagagttcaattgaacatgcaggTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0723 Rieske Fe-S protein ... can be seen here [C] COG1290 Cytochrome b subunit of the bc complex ... can be seen here     ..................................................................................................................