Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:208 nt.     Distance to run of Ts=3 nt.   Size=14 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -9.69 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gagcggttcctgtaaaaattgcaggcgagacagcttgaggattgggcgccgaaaggcgcccatttcttttgcgctttggaccggattttctggagcgccg
atctgctcggatcagatcggcgctccaacccattccatttcatgcataaacatgattgttcccgttccactccggttggattatgctctgaaagatcgca
aaggtgcttggcgtggctgccagatcgtgattgaagaatttcacaaacaggaccatgccagattagcctggggtaaggctgtctgctccccaccatcccc
TTG

    BMEI0476


Gene: BMEI0476     GI: 17986759     BI number: BMEI0476     GOG: COG0503     Description: ADENINE PHOSPHORIBOSYLTRANSFERAS


  c
t  c
a  c
c  c
c  T       ga
 aT       a  c
 cG       g  a
 cg        cg
 cg        gc
|  t       gt
|  t       at
|  c       cg
|  c      |  a
|  t      g  g
|  g       tg
|  t       ta
|  a       at
|  a       at
|  a      a  |
|  a      a  |
|  a      a  |
c  t      t  |
t  t      g  |
 cg        tg        aa
 gc        cg       g  a
 ta        cg        cg
 cg       t  c       cg
 tg        tg        gc
 gc        gc        cg
 tg        gc        gc
                        ccatttcttttgcgctttggaccggattttctggagcgccgatctgctcggatcagatcggcgctccaacccattccatttcatgcataaacatgattgttcccgttccactccggttggattatgctctgaaagatcgcaaaggtgcttggcgtggctgccagatcgtgattgaagaatttcacaaacaggaccatgccagattagcctggggtaaggctgtctgctccccaccatccccTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0503 Adenine/guanine phosphoribosyltransferases and related PRPP-binding proteins ... can be seen here

    ..................................................................................................................