                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGCCCGAAGGAAACCCGCGCCTGGACCATCAAGCGCGGCACCAAGGCGCCAGCCGC
AGCAGGCGTGATCCACACCGATTTCGAGCGCGGCTTCATCCGCGCCCAGACCATCGCC
TATGAAGACTATGTCAAATATAATGGCGAACTGGGTGCCAAGGAGGCCGGCAAGGCTC
GCGACGAAGGCAAGGAATACATCGTCCATGACGGCGATGTGATGCTGTTCCGCTTCAA
TACCTGAtacgatctggccgccgaaaaccggcggccttttctttatgcctattgggaggagacacaggGTG

    BMEI0478 --- BMEI0477 Gene: BMEI0478     GI: 17986761     BI number: BMEI0478     GOG: COG2030     Description: (R)-specific enoyl-CoA hydratase Gene: BMEI0477     GI: 17986760     BI number: BMEI0477     GOG: COG2030     Description: MONOAMINE OXIDASE REGULATORY PROTEIN, PUTATIV TG A  A C  C CG TG GC CG TA AT         A CG       T  C AT       A  C |  G       AT |  A       CG |  T       TA |  G      T  t |  C      C  a |  T       Gc TG        Cg AT       C  a AT       T  t        a GC       T  c      a  a GC        Gt       a  c A  G       Tg        gc A  |       Cg        cg C  |       Gc        cg G  |      T  |       gc GC       A  |       cg AT        Gc        cg AT        Tg        gc GC        Gc        gc                         ttttctttatgcctattgggaggagacacaggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG2030 Acyl dehydratase ... can be seen here [I] COG2030 Acyl dehydratase ... can be seen here     ..................................................................................................................