                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.16 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCAGTTGGCGGGCGGCGGTGTTGGTGGTATCGTGCTGACGGCTATTATCGGCCTGA
TCAAGAATTCGATGGCCGCCAAGGCCTGAcagagccagagcgcactagccggtgaggcgcgcttcatgcggcggtggaa
atttttcaacctgaaaagcaatgccgatcaggcaaggtgaattgttggagagggaaaaacggacggccaatcgccgtccgtttttattgtgcaaagcctt
cacgcgagcggggctgaccattatgtgtgaacaggaaccctataccgagttggagcaaagaacATG

    BMEI0496 Gene: BMEI0496     GI: 17986779     BI number: BMEI0496     GOG: COG0491     Description: HYDROXYACYLGLUTATHIONE HYDROLAS   c        tg a  c      g  a a  t      g  a cg        at ta        at ta        cg ta        gt ta       g  t tg       a  g a  |       cg a  |       ta a  |      |  g g  |      |  a gc       |  g ta       |  g g  a      |  g gt       |  a        a cg       |  a      a  t gc       |  a      c  c gc       |  a       cg cg       |  a       gc g  |      |  c       gc ta       |  g       cg at       |  g       at c  c      a  a       gc ta        gc        gc tg        cg        cg cg        cg        at gc        gc        at                         tttattgtgcaaagccttcacgcgagcggggctgaccattatgtgtgaacaggaaccctataccgagttggagcaaagaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_melitensis_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:155 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-16.20 kcal/mol Antiterminator: Size=45 nt.     Delta G=-12.50 kcal/mol Anti-antiterminator:   Size=57 nt.     Delta G=-16.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGCCAGTTGGCGGGCGGCGGTGTTGGTGGTATCGTGCTGACGGCTATTATCGGCCTGA TCAAGAATTCGATGGCCGCCAAGGCCTGAcagagccagagcgcactagccggtgaggcgcgcttcatgcggcggtggaa atttttcaacctgaaaagcaatgccgatcaggcaaggtgaattgttggagagggaaaaacggacggccaatcgccgtccgtttttattgtgcaaagcctt cacgcgagcggggctgaccattatgtgtgaacaggaaccctataccgagttggagcaaagaacATG     BMEI0496 Gene: BMEI0496     GI: 17986779     BI number: BMEI0496     GOG: COG0491     Description: HYDROXYACYLGLUTATHIONE HYDROLAS   C C  A G  A CG CG GC GC T  | A  | G  | C  | T  | T  |       cg A  |      g  c A  |      a  a G  |       gc A  |       at AT       c  a CG        cg TA        gc        gc A  |      a  c      c  g Gc       g  g       gc Ta       a  |       gt Cg        cg        at |  a       At        gc Cg       G  g       ta Gc        Ta        gt Gc        Cg       |  g C  a       Cg        gc T  g       Gc        cg A  |      G  |       cg T  |      A  |       gc T  |      A  |      a  | A  |      C  |       tg Ta        Cg        cg Cg        Gc        at Gc        Cg        cg                         gaaatttttcaacctgaaaagcaatgccgatcaggcaaggtgaattgttggagagggaaaaacggacggccaatcgccgtccgtttttattgtgcaaagccttcacgcgagcggggctgaccattatgtgtgaacaggaaccctataccgagttggagcaaagaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................