                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-21.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGTTATCATCCCAATTTCGGTCATGGTTTCGGTCACGGCTTTGGTCATGGGCCCCGC
ATGCGTCTCGGCGGCAGGCGGTAAGGCGCAGCGCAAAACCGGGCCTCCTGACAGCCTT
CTGTCAGGAGCATCGCCGGATTGGAAAAGGGTGAAGGGGATTTCGCTTCCACACTCTT
TTCATTTGAACGCTGAAATTCCATATTGGGAGCATGGCTTCCTCAAAAGACAAACATA
TCCGGGATTCGCGCAACAAGGCTGAcggcttcggcgaagcgccgcaggccgggttttccggcgcgcctTTG

    BMEI0501 Gene: BMEI0501     GI: 17986784     BI number: BMEI0501     GOG: COG0556     Description: EXCINUCLEASE ABC SUBUNIT CT C  T GC AT CG                  GG AT                 G  A GC                  GT TA                  AT CG                  AT CG        GA        GC TA       G  A       TG CG        TA        GC |  C       TA        GT |  A      A  G      G  | |  T      G  |      A  | C  C      G  |      A  | G  G       CG       A  | GC        CG        AT GC        GT        GC CG        CG        GC CG        TA        TA                         CACTCTTTTCATTTGAACGCTGAAATTCCATATTGGGAGCATGGCTTCCTCAAAAGACAAACATATCCGGGATTCGCGCAACAAGGCTGAcggcttcggcgaagcgccgcaggccgggttttccggcgcgcctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0556 Helicase subunit of the DNA excision repair complex ... can be seen here     ..................................................................................................................