                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aggccttttcgttatgagaccaatccaagggggcgatgggcattttcgccatattagctctcaagcgtaaaggaagagtcagtggccgcgttaagggctg
tggcacaagatgggcgcaagatgggaaatggcctcacctcaaattgaatacaggatccggcttgctgaaatgagcgcaggattggcaagatcctgtcttt
gttctatcaccatgcggcggtttagggccatgccgccgacagagccattctcccggtccctgaagtcttttccatgtcagcactgatttcgccaagcctc
TTG

    BMEI0505 Gene: BMEI0505     GI: 17986788     BI number: BMEI0505     GOG: COG3169     Description: Hypothetical Membrane Associated Protei ca t  a c  a c  t at cg ta c  a c  t g  a       aa gc       a  t ta       g  g a  g       ta a  g       cg a  a       gc         c gt       t  |      g  a gc       t  |      g  a gc        cg        tg tg        gc        ta a  g      g  a       at gc        cg        gc at        cg        gc at        ta        at cg        at        cg gc        gt        gt                         ctttgttctatcaccatgcggcggtttagggccatgccgccgacagagccattctcccggtccctgaagtcttttccatgtcagcactgatttcgccaagcctcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3169 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................