                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=13 nt.     Delta G= -3.20 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGTGCAATTCGCCGCAAAATCGCAGAGGACTGATACATCGCGGATCTGTTTGTAACC
CGCCTGGGAAGGGCTTCCGGCCAAAAGCAGAAAGGTTGTGGCAAAACCGGACAATGCC
CCAATCCGGGAACCATGATTCTTAAAGAACATaaaacacctgccaatgaaaactgttccggttccatgcgagaatg
tcgcatagcggaatgcccccttgccgcttccgcatgatattgcctatagcgtagcggtcgacaaggtcgaaatattcgccttcggcttttcttttccata
acgaggtaATG

    BMEI0506 Gene: BMEI0506     GI: 17986789     BI number: BMEI0506     GOG: COG0697     Description: TRANSPORTER, DME FAMIL   c g  c t  t ta at ta a  g gc tg                   t at                 a  a |  a                 at cg                  at gc                  gc cg                  cg cg                 t  | t  t                 gc t  |                 gc c  |                 at gc                 a  | cg         a       c  | c  a      a  g       at gc        cg        gc ta        at        cg ta        gc        tg cg        cg        gc cg        ta        gt                         tttcttttccataacgaggtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................