                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.26 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-14.41 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCTGCAAGCTGGCCACCCAAAACGAAGTGAaccggcaagggatcgcagaattaacaggccggaatttttctgcg
tgaaataatgggtaaaaatgttatagtccggccaacagcgatttaaacggttccgaggcagatgtcttggtgaccgttttctttttgtgtgtcgagggcg
gattggccttcacaaagcgcctcgcgctatccgagcatcgcgcgaggtgaggcgggcaaggcaaactgccggtgcggccagattcctgaaaagggccggc
gccgggcgaaggaaaggactgggtATG

    BMEI0508 --- BMEI0509 Gene: BMEI0508     GI: 17986791     BI number: BMEI0508     GOG: COG0782     Description: TRANSCRIPTION ELONGATION FACTOR GREA Gene: BMEI0509     GI: 17986792     BI number: BMEI0509     GOG: COG0438     Description: LIPOPOLYSACCHARIDE CORE BIOSYNTHESIS MANNOSYLTRANSFERASE LPC aa a  t g  a ta gt cg g  | tg cg |  t ta ta         a ta       g  t       ga ta       c  t      a  t ta       g  t       cg at       a  a       gt |  g      c  a       gc |  t      a  a       at |  t      a  c       gt |  a       cg        cg |  t       cg        cg |  a      |  t      |  t |  g      |  t       tg at        gc        ta gc        gc        gc gc        cg        gc cg       |  a       cg cg        cg        at gc        tg        at gc        gc        at                         tctttttgtgtgtcgagggcggattggccttcacaaagcgcctcgcgctatccgagcatcgcgcgaggtgaggcgggcaaggcaaactgccggtgcggccagattcctgaaaagggccggcgccgggcgaaggaaaggactgggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................