                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-19.00 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgcacaagccagaaattggctcgcgaacggttcggtttggttataacatccttagagaaagcataaggtggcaaagaattttcgtgaatgcccgcacttt
ctttgaaataaagcgatttgtggggttccgcttatgaaaatgattgcctataaggcccgcttagcccgcagaattcataagctgccaacccgccggaaaa
ccgtgcgggcttttctggcaggctacgaaagcatgtctcttggaagtgggacccggtttccgggccagaccatgcgcgaacgaagataggatgagcgccc
ATG

    BMEI0522 Gene: BMEI0522     GI: 17986805     BI number: BMEI0522     GOG: COG0458     Description: CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAI             c           c  c           g  g            gc            at            at            ta           |  g           a  c           t  c           c  c            cg            gc aa        ta g  a       tg ta       a  a at       g  a tg       t  | ta       a  | c  t      a  | gt        at cg        at c  |       gc t  |       ta t  |       at g  |       ta gc        ta gc        cg        aa gt        gc       a  a ta       |  t       gc gt       |  g       gc ta       c  c       cg ta       c  c      |  t tg        ta        cg a  |       ta        gc g  |       gc        cg cg        gc        cg gc        gc        cg                         cttttctggcaggctacgaaagcatgtctcttggaagtgggacccggtttccgggccagaccatgcgcgaacgaagataggatgagcgcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EF] COG0458 Carbamoylphosphate synthase large subunit (split gene in MJ) ... can be seen here     ..................................................................................................................