                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G=-18.24 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGGCAGGGTTTTTCGCGTTCATGCCGGGACGCATCATGAATGAAGTCGCCTTTCCC
TATGGCTGGCAGTCGCCATTTCTCGTGGCATGTCTTCTGATGGCACTGGTTGCAGCAG
TTTTTGTCTATCGAAGCAAAAGCGGCTTTCTTGTACCCAAACTATTGCGAAAGAGTCT
TCGTTTGTGAtcagcgatgccatttactttttatgttgccgtgcgaactctttatgcgacaattacctatgatgaaatgatgccgttttgttc
aaggcggcgcggagcagggggagtggttgttcaATG

    BMEI0525 Gene: BMEI0525     GI: 17986808     BI number: BMEI0525     GOG: COG2321     Description: ZINC PROTEAS CA G  G G  T T  C CG GC GC TA AT T  T C  T C  C C  T T  C        G T  G      T  G T  T      C  T CG        AT CG        CG GC        GC C  |      G  A TA       T  G       TC GT       A  |      A  G A  G       GC       T  A AT        TA       C  A GC        CG        TG T  |      T  T       GC AT       T  T       TA AT       C  T       TA GC       T  T       TA T  |      G  |       TA AT       T  |       TG CG        AT        GC TA        CG       A  G AT        GT        CG CG        GC        GC                         TTTCTTGTACCCAAACTATTGCGAAAGAGTCTTCGTTTGTGAtcagcgatgccatttactttttatgttgccgtgcgaactctttatgcgacaattacctatgatgaaatgatgccgttttgttcaaggcggcgcggagcagggggagtggttgttcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2321 Predicted metalloprotease ... can be seen here     ..................................................................................................................