                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATCAGGTTTGCGGTGTCATTTCCAAGACCATCGATGGCGAAGTGAAGGAATATCGT
TTTGTGCGTGCGGATCGTTGCCCCGGCATTGAAGATGCCGCCAGCATCGCGCTGAACA
AGGGCCGCCAGATCATCGATGAACAGGGCGAGCGCATTTTCGGCTGAgcatcgctacaggattga
gcgccgcgtatcatgaatgcgcggcgttttcatttttataagcggaagcgaagcattgcacgctgacagttccccgcgacgcggctgtttgactgaacga
tgcggatattcaatcgcggATG

    BMEI0534 Gene: BMEI0534     GI: 17986817     BI number: BMEI0534     GOG: COG2983     Description: Hypothetical Cytosolic Protei CG T  A AT CG TA |  A        t A  C      a  c G  A       cg A  G       gc CG        At CG       |  a        t GC        Gc       a  g CG        Ta       c  a |  A       Cg        ta CG       G  |       at GC       G  |       tg G  G       Cg        gc G  C       Ta        cg A  A      T  t       gc A  T      T  t       cg C  T      T  g       cg AT       A  a       gc AT        Cg        cg GC        Gc        gt TG        Cg        at CG        Gc        gt                         tcatttttataagcggaagcgaagcattgcacgctgacagttccccgcgacgcggctgtttgactgaacgatgcggatattcaatcgcggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2983 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................