Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=2 nt.   Size=16 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGATGATGACGATTATCTCGACCACATGGTCACACCAGACAAAATTGCCCGGTAAa
tcttgttttaccaaacattgctaaaatttaatcctgtgccgggagcaggcgatcttatgatcgcagtttcttcagtatattgattttattgaatttttaa
tgatggagttcaatcggtaattgccgttggcgctgcatgtgaacgccagatgaaagggtctttgcctttccgttcatcatttggggactaactatcgggt
gtctcaggcgaaagcccgaaagcaaatcgaaagaggttcagaATG

    BMEI0535


Gene: BMEI0535     GI: 17986818     BI number: BMEI0535     GOG: NOG09767     Description: Hypothetical Protei


 tt
c  g        g
t  t      t  c
 at        gc
 At        tg
 At        cg
 Ta        cg
 Gc        ta
 Gc       a  g
C  a      a  c
C  a      t  a
C  a      t  |
 Gc       t  |
 Ta       a  |
T  |      a  |
A  |      a  |       ta
A  |      a  |      t  t
 At        tg        cg
 At        cg        ta
 Cg        gc        at
A  |       tg        gc
 Gc        ta        cg
 At        at        gc
                        agtttcttcagtatattgattttattgaatttttaatgatggagttcaatcggtaattgccgttggcgctgcatgtgaacgccagatgaaagggtctttgcctttccgttcatcatttggggactaactatcgggtgtctcaggcgaaagcccgaaagcaaatcgaaagaggttcagaATG
    ..................................................................................................................