                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-19.90 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-13.03 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAGGCGACAGCCATGTCGAATGGTTTGAAGGCAATTTCGAGGACTATGAAGCTGAC
AAAATCCGCCGTCTTGGGCCGGATAGCGTCAACCCGAAACGGGTAACTTACAAGCCGC
TGACGCGGTGAtgactttcagggccggtgcatcgcaccggcctttttatttcaggcccttttcacgggatgaaaggaaagatgatgaaagac
tggtctgcaaaacagtatctgaagtttgaagatgaacaagccgcccggcgcgcgatcttctggcgcagatacctctgtcggcgccgcgcaagGTG

    BMEI0554 Gene: BMEI0554     GI: 17986837     BI number: BMEI0554     GOG: COG4106     Description: TRANS-ACONITATE METHYLTRANSFERAS   A A  A GC CG CG CG AT |  A |  A |  C |  T |  T |  A |  C |  A       At |  A      G  g |  G       Ta |  C       Gc |  C       Gt |  G      C  t |  C      G  | AT       C  | CG        At         t TA        Gc       a  c GC        Ta        cg CG        Cg        gc GC       G  |       ta A  |       Cg        gc T  |       Cg        gc A  |       Gc        cg G  |      A  c       cg G  |      A  g       gc CG        Cg        gc CG        At        gt GT        Tg        at                         tttatttcaggcccttttcacgggatgaaaggaaagatgatgaaagactggtctgcaaaacagtatctgaagtttgaagatgaacaagccgcccggcgcgcgatcttctggcgcagatacctctgtcggcgccgcgcaagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4106 Trans-aconitate methyltransferase ... can be seen here     ..................................................................................................................