                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:129 nt.    Distance to gene:62 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:112 nt. Size=34 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaca-tagatt. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaacaacttcttatattgggatagattgcatacaaacgattttgttcCTATGGTCTGGCCGCATCCTGAAACCGCTC
TAGATATGGAGCTGTCATGATCGCAACGCCGCGATGCGCATCATCTCGGCTGCGATTT
TGACCGGGAGGACATTTCAAATGCGAGGCTGCTTTCCGATTGAAATGCAGTTCGTACT
TTTGTTTGTGAAGTGAAACAATCGTCGCTTTTGATAATCCCCGTATGGGATAGACGGC
TTGCAGGCTGTTG

    BMEI0556 Gene: BMEI0556     GI: 17986839     BI number: BMEI0556     GOG: COG0477     Description: ALPHA-KETOGLUTARATE PERMEAS             A AT       G  T A  G      C  T A  C       CG CG        TA TA        TA TG        TA TG       |  T |  C       CG AT        GC CG        TA A  |       CG GC       G  | GT        GT AT        AT GT        GC GC        CG GC        GT CG        TA             CTTTTGTTTGTGAAGTGAAACAATCGTCGCTTTTGATAATCCCCGTATGGGATAGACGGCTTGCAGGCTGTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................