                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-13.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATACGGGCCCCATCCATGGACCTTCTGGCAATATACCGGAACCGGCTCCATTCTCGG
CATCCGCGGCGATGCGGACATCAACACCTTTGCCGGTGACAGTGCATCCTGGAAAAAG
TGGCTGGAAAGCAACAAAGTGCGCTAAccaggcacgaatcgaccgctcacattaagttttgcttcatttctttgctttga
tggggcaatagctaaccaaaccgtaaaggggggccagcgccacccaacttagcgtgagttgttttccatgaagattatcgcctcagttctggctgcggcc
ttgtTTG

    BMEI0561 Gene: BMEI0561     GI: 17986844     BI number: BMEI0561     GOG: COG2951     Description: MEMBRANE-BOUND LYTIC MUREIN TRANSGLYCOSYLASE ag c  c cg gc gc |  a        a gc       c  t gc        cg gc        ta |  a       ta |  a       tg gc        ta at        gt at       t  t a  a      t  a tg       g  | gc        at cg        gc c  |       tg        ct a  |       gc       t  g a  |      c  |       tg at        gc        gc cg        at        at |  a      t  c       cg cg        ta       t  c at        cg        cg at        at        cg tg        at        gc                         cttgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2951 Membrane-bound lytic murein transglycosylase B ... can be seen here     ..................................................................................................................