                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:180 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-23.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTGCACTGGGAAATCAAACGTCTCGGTTTGTTCCGCGAAGGGGAGCAGATCGAGGAG
TTTCTTGGAAAAATAGTATAAaaaagttgcccggattttccccctgaaattccgggcttttttagccttgcaagctggccgcaag
gtttgtccctttctatagggtcttgtcacggaatcaaacctctgattctttatggttaaccgtacagtgatttgattcggcaggattttcctgctgtggg
tgcctgcggcttgcgtcgccgggttatccggactctgttcttgatttatgcgcaggaATG

    BMEI0582 --- BMEI0583 --- BMEI0584 Gene: BMEI0582     GI: 17986865     BI number: BMEI0582     GOG: COG1181     Description: D-ALANINE--D-ALANINE LIGASE Gene: BMEI0583     GI: 17986866     BI number: BMEI0583     GOG: COG1589     Description: CELL DIVISION PROTEIN FTSQ Gene: BMEI0584     GI: 17986867     BI number: BMEI0584     GOG: COG0849     Description: CELL DIVISION PROTEIN FTS             A   A       T  A G  A      A  a C  G      T  a G  G      G  a CG       A  a CG        Tg TA        At TG        At GC       A  g        c TA       A  |      c  c TG       A  |      c  t TA        Gc        cg GT        Gc        ta GC       T  c       ta CG        Tg        ta TA        Cg       t  t CG        Ta        at T  G      T  t       gc G  A      T  t       gc CG        Gt        cg AT        At        cg AT        Gc        cg AT        Gc        gc                         ttttttagccttgcaagctggccgcaaggtttgtccctttctatagggtcttgtcacggaatcaaacctctgattctttatggttaaccgtacagtgatttgattcggcaggattttcctgctgtgggtgcctgcggcttgcgtcgccgggttatccggactctgttcttgatttatgcgcaggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here [M] COG1589 Cell division septal protein ... can be seen here [D] COG0849 Actin-like ATPase involved in cell division ... can be seen here     ..................................................................................................................