                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:95 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:93 nt. Size=18 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:    Distance from promoter:53 nt.    Size=47 nt.     Delta G=-12.93 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacg-cgtaat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacgttgaaagggtggctgcgcgtaatgtgataaggtgttagaaagcgtgattttgaaccggaaggctcgttcattatttcagccaaaagtgcttata
caggcgcttcaattgcaaagtccgggctgtccgcatcccgccgatcaggatggccttttatccctgttatactgaatagattggaactgtcTTG

    BMEI0586 Gene: BMEI0586     GI: 17986869     BI number: BMEI0586     GOG: COG0774     Description: UDP-3-O-[3-HYDROXYMYRISTOYL] N-ACETYLGLUCOSAMINE DEACETYLAS ta a  c ta tg cg gc tg gc at at |  c |  a |  a |  t |  t                  g |  g                c  c |  c                c  c |  a                 cg |  a                 ta |  a                 at |  g                c  c |  t       cc       g  a |  c      t  g       cg a  c       gc        cg a  g       ta        ta cg       c  t       gt cg        gc        tg gc        gc        cg at        gc        gc cg        cg        gc                         ttttatccctgttatactgaatagattggaactgtcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0774 UDP-3-O-acyl-N-acetylglucosamine deacetylase ... can be seen here     ..................................................................................................................