                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGGATGAGCGGCAGGAGGAAATTGCGCGTATGCTGGCTGGCGCCAGCATCACCGAT
GAGGCGCGCGCGGCAGCCGAACGCCTTCTGGCTGAAAATGGCGCGCCCGCATCCTGAc
aactccctggcagcatgccttgttcgtaaaggatggcgccagtaggcgggagcgcatttcttggttatgttgcagccgattcaagatagtcaggatttgc
tgcttagagcagttcctgttttaacggaatcgccggaaccgctctgcgcaaaaccgtttcacacttttgctggaaatgctctagATG

    BMEI0589 --- BMEI0590 Gene: BMEI0589     GI: 17986872     BI number: BMEI0589     GOG: COG0272     Description: NAD-DEPENDENT DNA LIGASE Gene: BMEI0590     GI: 17986873     BI number: BMEI0590     GOG: COG5587     Description: hypothetical protei   c g  a c  t gt at gc gt gt cg g  g gt at ta        ta gt       a  g |  g      g  t        a a  t      a  c      t  g c  t      a  a      t  a cg        cg        cg gc        tg        gc |  a       ta        ta cg        at        cg gc        gt        gt gc       c  t      t  | |  g       cg       t  | ta        gc       t  | at        at        at gt        cg        gc gc        gc        gc                         tgttttaacggaatcgccggaaccgctctgcgcaaaaccgtttcacacttttgctggaaatgctctagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0272 NAD-dependent DNA ligase (contains BRCT domain type II) ... can be seen here [S] COG5587 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................