Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=3 nt.   Size=18 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCCTATTCGCCGTTCGACCTGATCGTCGCCAATATTCTCGCCAATCCGCTTATCGA
GCTTGCACCATCCATCAAGGAACATCTGGCGCCCGGCGGGTCCATCATTCTTTCCGGC
ATACTTGACAGCCAGCATGATGCAGTGCTCGCTGCCTATCAGACTCAGGGCCTCACCC
ATCAGAAAACCCTCCACCGTGAAGGATGGGTGGCAATTCATCTGAAATAAcgcttcatctgac
ataaatctgacataacaggccgtctgaacagcggcgccttcctgtttcgagcgagttatatccATG

    BMEI0591


Gene: BMEI0591     GI: 17986874     BI number: BMEI0591     GOG: COG0006     Description: XAA-PRO AMINOPEPTIDAS


  C
T  A
A  A
 CG
 CG
 TA
|  A
|  C
|  A
|  T
|  C
 AT
 CG         G
 CG       G  C
A  C       CG
 CG        CG
 GC        CG
|  C       GT
T  C      C  |
 TG        GC
 CG        GC
 GC        TA
            TCATTCTTTCCGGCATACTTGACAGCCAGCATGATGCAGTGCTCGCTGCCTATCAGACTCAGGGCCTCACCCATCAGAAAACCCTCCACCGTGAAGGATGGGTGGCAATTCATCTGAAATAAcgcttcatctgacataaatctgacataacaggccgtctgaacagcggcgccttcctgtttcgagcgagttatatccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0006 Xaa-Pro aminopeptidase ... can be seen here

    ..................................................................................................................