                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:210 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctgacgtcaatcagtttgggatctaatatatatgctgcgtatcatcgcccaagcagttctctggctaagcggtcttatcgccgctttctttgtggccag
ggacgagtcgaacttccctctccttcaaatgacggtggggcttctgctgcttgtgggagtttcggtcgcgatctggtggttcaccgatccggacaggtcg
aaaaaataaaacagccggagcggactgccttcgacctcacttgcgcaaacgggacgatgcgcgcaatattgcgcaaatctgtcataacaccgtgaccctc
ATG

    BMEI0602 --- BMEI0601 Gene: BMEI0602     GI: 17986885     BI number: BMEI0602     GOG: NOG09853     Description: Hypothetical Protein Gene: BMEI0601     GI: 17986884     BI number: BMEI0601     GOG: COG4321     Description: hypothetical protei   g t  c a  t t  g a  c tg        tc at       t  t ta        gc at        at a  c      |  g t  a       cg c  t       gc t  c       at        ta a  g      a  a      t  t gc       c  a      c  c gc       c  |       tg gc        cg        gc ta        gc        gc ta        cg        cg tg        tg        gc gc        at        at                         ttctttgtggccagggacgagtcgaacttccctctccttcaaatgacggtggggcttctgctgcttgtgggagtttcggtcgcgatctggtggttcaccgatccggacaggtcgaaaaaataaaacagccggagcggactgccttcgacctcacttgcgcaaacgggacgatgcgcgcaatattgcgcaaatctgtcataacaccgtgaccctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4321 Uncharacterized protein related to arylsulfate sulfotransferase involved in siderophore biosynthesis ... can be seen here     ..................................................................................................................