                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.95 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTTTCGGCAAGCGATCCGGAAGAAATGAAGCGCGTTCGCACCAACTGGGTTGCCAA
GAAACTGGGCGTCGAGGACGTCGCCAAGGGTGACGAAGTGGTGGCCCATGTGGCCGAG
GTGATGAAGGGCGACCGCAACAAGCACCGCGTGACCTTCTATTATCTCGTGGCCAAAC
AGCTCGGCAAGCTTGGCGCCCTCTGAacgccgtggcacatttgcctgttgaatccgaagccccggtgcctcacaccggggt
ttttccttatagtgatcgggaaacgaatcggcccggaacaaatctATG

    BMEI0608 --- BMEI0609 Gene: BMEI0608     GI: 17986891     BI number: BMEI0608     GOG: COG0207     Description: THYMIDYLATE SYNTHASE Gene: BMEI0609     GI: 17986892     BI number: BMEI0609     GOG: COG0262     Description: DIHYDROFOLATE REDUCTAS            gt           t  t           c  g           c  a           g  a           t  t   C       t  c T  T      t  c C  G      a  g C  A      c  a        t C  a      a  a      c  c Gc        cg       c  a Cg        gc        gc Gc        gc        ta Gc       t  c       gc Tg        gc        gc |  t       cg        cg Tg        cg        cg Cg        gt        cg Gc        cg        cg                         tttttccttatagtgatcgggaaacgaatcggcccggaacaaatctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0207 Thymidylate synthase ... can be seen here [H] COG0262 Dihydrofolate reductase ... can be seen here     ..................................................................................................................