                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGACGCCGGAAGATGTGAAAAAGCGTATCGATGCACTGCGCCGCGAGGGGCGCAAGA
ATGCGCTTTTGATGCTGGCTTCGCGTTCCGGGGAGTTGCGTTTCGTGACGATCCGTAT
CGACTGAttgtttttggatggatgaaggacggcgccgaacggaaacctgcggtgccgttttgtttcatggtttgaatcgcttggcggcaagtgcg
cagaaagtgattcaatcgcgttggctttgtgaggcggtgagttggaaacggttgatgttgtcgtgatcggcgccggcgcggcgggcatgATG

    BMEI0614 Gene: BMEI0614     GI: 17986897     BI number: BMEI0614     GOG: COG2081     Description: NAD(FAD)-utilizing dehydrogenase            ga           g  c TC       a  g       aa A  G      a  g      a  c TA        gc        gc GC        tg        gt C  T      a  |       cg CG        gc       a  | TA        gc       a  | At        tg        gc Gt       a  a       cg Cg       g  a       cg At        gc        gt Gt        tg        cg |  t       tg        gc T  t       ta        gc Gt        ta        cg Cg        ta        at Tg        gc        gt                         ttgtttcatggtttgaatcgcttggcggcaagtgcgcagaaagtgattcaatcgcgttggctttgtgaggcggtgagttggaaacggttgatgttgtcgtgatcggcgccggcgcggcgggcatgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2081 Predicted flavoproteins ... can be seen here     ..................................................................................................................