                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:68 nt. Size=10 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:    Distance from promoter:48 nt.    Size=23 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacg-tagtgt. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacgacacctttgctcgctattagtgtccgcaagcatgaacacgatcattattcttgtagtacgggcgcgcatgggcagggtggtgtaaccacccggc
gaaagctcccatgcgcgaaagacaggctccctcgggggcttttttattatccaaatcagaaatgaaatgcagacgacgggaagagaacgATG

    BMEI0617 --- BMEI0618 Gene: BMEI0617     GI: 17986900     BI number: BMEI0617     GOG: COG0028     Description: ACETOLACTATE SYNTHASE LARGE SUBUNIT Gene: BMEI0618     GI: 17986901     BI number: BMEI0618     GOG: COG0440     Description: ACETOLACTATE SYNTHASE SMALL SUBUNI                       g                     a  a                     a  c                     a  a                     g  g                      cg                      gc                     |  t                     |  c   t                 c  c g  a                g  c t  a                t  t gc                 a  c gc                  cg ta                  cg gc                  cg gc        aa        tg gc       g  a       cg a  g       cg        gc cg        gc        at gc        gt        at                         ttttattatccaaatcagaaatgaaatgcagacgacgggaagagaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0028 Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] ... can be seen here [E] COG0440 Acetolactate synthase, small (regulatory) subunit ... can be seen here     ..................................................................................................................