                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgggacaagctctagggcagtctgccactgtcataagcgtcgggggcgcgccgggccgcatgggggaagcattgaagcagttttccgaaattcgcattcc
gcgccgaaatattccggctctttgcattcgcgcagagtgtttccttcaatcggcatgatgcttatgactaaagctaatcagggcaaagatgcggcaggga
tgtcgcaaagtgcaacttttttcgcccgtccacattattccatcctgaccctcagtctctccggccagtacactttcaggaaattgcgaggtgcctgcat
ATG

    BMEI0622 Gene: BMEI0622     GI: 17986905     BI number: BMEI0622     GOG: COG3158     Description: KUP SYSTEM POTASSIUM UPTAKE PROTEI            ag           a  c   g        at t  a       ta a  t      c  a cg        at        gg gc        gc       g  a gt        ta        at c  t      a  |       cg t  a       tg        gt a  |       tg        gc at        cg        cg cg        gc        gc ta        ta        ta t  c      |  a      a  a c  t      a  a      g  a c  a      g  g      a  g ta        ta       a  | ta        at        at tg        cg        cg gc        gc        gc                         aacttttttcgcccgtccacattattccatcctgaccctcagtctctccggccagtacactttcaggaaattgcgaggtgcctgcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3158 K+ transporter ... can be seen here     ..................................................................................................................