                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-22.20 kcal/mol
Antiterminator: Size=80 nt.     Delta G=-15.41 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-21.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATGCCACCGAATATTTCCAGATCCCGACCGGGCGGGTGGTCGAGATCGGAACACAG
GTGAATATCTAAagcctttcccttaaaaaaaggggtagaaaaaagcgcctttcggaagctcccgaaaggcgctttttgtctatggcgcgac
cgggcaaacggctcgcaaaaaatttcacgatgaatatgcgaaatttctggaaaacatgcttgaccgctggcaaaacagaaattaaaaatcaggaaccgta
ccgtacggtacaaggtggaggaaatgatacgtgactgatacaggcgacgaaTTG

    BMEI0623 Gene: BMEI0623     GI: 17986906     BI number: BMEI0623     GOG: COG1309     Description: TRANSCRIPTIONAL REGULATOR, TETR FAMIL             a           a  a           a  a            ta            ta            cg            cg            cg            tg           t  |           t  |           c  |           c  |           g  |           a  |           A  |            At            Ta            Cg            Ta           |  a CG       |  a G  G      A  a G  G      T  a GT       A  a CG       A  g CG        Gc AT        Tg GC        Gc CG        Gc C  A       At CG       C  | TA       A  | AT       C  | GC       A  | A  |      A  |       gc CG       G  |      a  t CG       G  |      a  c TA       C  |       gc TA       T  |       gc T  C      A  |       cg A  A       Gt        ta T  C       At        ta A  A       Gc        ta A  |       Cg        cg G  |       Tg        cg CG       G  a       gc CG       G  a       cg AT        Tg        gc CG        Gc        at                         ttttgtctatggcgcgaccgggcaaacggctcgcaaaaaatttcacgatgaatatgcgaaatttctggaaaacatgcttgaccgctggcaaaacagaaattaaaaatcaggaaccgtaccgtacggtacaaggtggaggaaatgatacgtgactgatacaggcgacgaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1309 Transcriptional regulator ... can be seen here     ..................................................................................................................