                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAGAATAATTTTTCTCATgacatgcttccccaccgccaccgctgtacaaagggcgtagttttcaaattgaatttagaaaacaa
atctagcggcaaatgaagcaaaatcaatctaaatcattgatttaaatatataaactactttccaaatgttttatggaacttggacctatcgcgctatcgt
acgggagaaaatatttcccgcttccaggcctggcgtaaaacaaaaacaaaggccggaaacttgcgcttccggcctcgaatttttttctggcaatgcctga
ttaccagaatccacgGTG

    BMEI0672 Gene: BMEI0672     GI: 17986955     BI number: BMEI0672     GOG: -------     Description: Hypothetical Protei   a a  t a  a at gt at gc         c gc       a  a gc       a  a cg       a  a |  c      a  a |  t       ta |  t       gc a  c      c  a       tg t  c      g  a      t  c g  a      g  |      c  g cg        ta       a  c tg        cg        at |  c       cg        at |  c       gc        gc at        gc        gc tg       a  |       cg cg        cg        cg gc        cg        gc cg        ta        gc gt        ta        at                         cgaatttttttctggcaatgcctgattaccagaatccacgGTG     ..................................................................................................................