Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGCGCCGGGCGTCGGTTTTGGTGAACATGGCGACGATTATGTGCGCATCGCGCTGG
TGGAAAACGAGCATCGCATTCGTCAGGCCGCGCGCAATATCAAGCGGTTCTTTTCTGC
CAAGGATGAGAACCTGCAAAATGTGATTCCGCTTGAAGGTCACCGCTAGacggcattcccacct
ttgcgggctggcccatgtttgcaggctgggctatgcttgcggccgcccatgctcgcgggctggatttatcctgcccgcagttctcacccgatgaaaccac
tccagtagaaggtcgaaataATG

    BMEI0725


Gene: BMEI0725     GI: 17987008     BI number: BMEI0725     GOG: COG0460     Description: HOMOSERINE DEHYDROGENAS


  C
G  A
A  T
 GC
 CG
A  C
A  A
A  |
 AT
 GT
 GC
T  G
G  T
 GC
 TA
 CG        AT
G  |      A  A
 CG       C  T
 GC       G  C
C  C      C  A
T  |      G  A
A  |       CG
 CG        GC
 GC        CG
 CG        CG
 GC        GT
 TG        GT
            CTTTTCTGCCAAGGATGAGAACCTGCAAAATGTGATTCCGCTTGAAGGTCACCGCTAGacggcattcccacctttgcgggctggcccatgtttgcaggctgggctatgcttgcggccgcccatgctcgcgggctggatttatcctgcccgcagttctcacccgatgaaaccactccagtagaaggtcgaaataATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0460 Homoserine dehydrogenase ... can be seen here

    ..................................................................................................................