                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATCAAGGCGCGCCATCAGGATTTGTCCAAATTCTAGagcatttccagcaaaagtgtgaaacggttttgcgtt
ggaaaatgcgataaaataaatagttagagcggttccaacgattccgttttaatcggaaccgctctaggacatatatgagatcgaacggcctgccgtttca
gaccccgaaaagcgtatcgtttttcggggtttttgatttgatacgctccatcggcaactgtatgatgccgcgatattttaggcccttgatggggacgaca
ttatatagccgaacttgatccggatttTTG

    BMEI0727 Gene: BMEI0727     GI: 17987010     BI number: BMEI0727     GOG: COG1181     Description: D-ALANINE--D-ALANINE LIGASE ct c  g gc gc cg at at |  t |  c |  a |  g |  a |  c |  c        a |  c      t  t gc        gc cg        cg ta        gt |  a       at a  a       at g  a       at a  g       at gc        gc tg        cg at        cg ta        cg at        cg             tttttgatttgatacgctccatcggcaactgtatgatgccgcgatattttaggcccttgatggggacgacattatatagccgaacttgatccggatttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here     ..................................................................................................................