                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:83 nt.    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.60 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=43 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:    Distance from promoter:22 nt.    Size=49 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-ttagtt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaagcccgcaaatacaggcttagttgagggcatcagaagaagccattgacttgtcaggcgtttttctgatctccagatttcatgttgcggacagtt
cctgctcgcaccagggccggtcgggaaactccgccggcctttatttttaacatattctaccctatcaacatgtgtgatgcgcagggaaggcgaaccgtaa
ggggcgcctgccgatgcttccgaaagacaagagagagcagcacttcatgagcattccccagccggaaATG

    BMEI0739 Gene: BMEI0739     GI: 17987022     BI number: BMEI0739     GOG: COG0705     Description: INTEGRAL MEMBRANE PROTEIN (Rhomboid family   c t  t a  c gc ta         t cg       t  c ta        gc |  t       at t  t       cg t  t      a  c t  c      g  t ta        gc gt        cg        aa cg        gc       a  c gt        ta        gt gt       t  c       gc |  g       gc        gc |  c       ta        cg a  g      a  g      t  | cg        cg        gc ta        tg        gc gc       |  c       cg t  |      |  c       cg ta        tg        gc cg        tg        gc at        at        gt gt        gc        at                         tatttttaacatattctaccctatcaacatgtgtgatgcgcagggaaggcgaaccgtaaggggcgcctgccgatgcttccgaaagacaagagagagcagcacttcatgagcattccccagccggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0705 Uncharacterized membrane protein (homolog of Drosophila rhomboid) ... can be seen here     ..................................................................................................................