                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-10.36 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTGTCGGCGTCTGGTTTCTCATCAATATCGTCACCGGCCTTTATTCCACTGGCGGC
GCTGACTTTTCCAGCATTGCCTGGGAGGCGCATATAGGCGGCTTCATTGCCGGGTTTT
TCGGGATTCCACTGATGGACCGCCCGCGCAGCTATGATGCCGTTTTGAGGCGATAGat
cctgcgccatttctggctttgaccaagccttcccctatttgatgccacttgccaatcaggcgatcaaagcgcaccatcatggaacgcggtcgaagggaac
tgcgttttgcttcatatggcatttaaATG

    BMEI0740 Gene: BMEI0740     GI: 17987023     BI number: BMEI0740     GOG: COG0517     Description: INOSINE-5'-MONOPHOSPHATE DEHYDROGENAS TT T  A C  T C  T GC GC C  A C  C AT CG TG GC CG T  | A  | T  | A  |        T A  |      T  T       AT C  |      C  T      T  A T  |      A  C      A  G A  |       GC        CG C  |       TA        GC T  |       CG       |  G C  |       GC        CG T  |      C  A       GC T  |       GT        GT T  |       GT        AT G  |       CG        GC G  |       GC       |  A T  |       GC       |  T C  |      T  T      |  T TG       C  G      |  G GC       A  |       GC CG        CG        GC GC        CG        TG GT        TA        CG CG        TG        CG                         TTTTTCGGGATTCCACTGATGGACCGCCCGCGCAGCTATGATGCCGTTTTGAGGCGATAGatcctgcgccatttctggctttgaccaagccttcccctatttgatgccacttgccaatcaggcgatcaaagcgcaccatcatggaacgcggtcgaagggaactgcgttttgcttcatatggcatttaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0517 FOG: CBS domain ... can be seen here     ..................................................................................................................