                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgctcttgcgagcgaggcgcgggttccggctttgcagtgctgccgagataataattccccgcatgctgtgttggccaggtggggaagggtcgccgttac
acgattggatggtgtgatgagcgatattcgcaaggatcggaactccgataagcctgtatggtgttcttttaacctttgggcttgtcttttgcgggaatcg
attctatgtagcgtcaacagacacgcggtgcgtggggctgaaaattcagctttgcgcgccgtccacgcgtgacctccgacatttgattcgcttttgctga
TTG

    BMEI0743 --- BMEI0744 Gene: BMEI0743     GI: 17987026     BI number: BMEI0743     GOG: COG0690     Description: PROTEIN TRANSLOCASE SUBUNIT SECE Gene: BMEI0744     GI: 17987027     BI number: BMEI0744     GOG: COG0250     Description: TRANSCRIPTION ANTITERMINATION PROTEIN NUS ac a  t gc gc cg ta at g  a        t g  a      c  t a  |      t  t a  |      t  t cg       g  a gc        ta c  c       gc t  t       gc tg       t  t at       a  t ta       t  | at        gt |  g       tg |  g       cg gt        cg cg        gc gt        at at        at gc        tg             tcttttgcgggaatcgattctatgtagcgtcaacagacacgcggtgcgtggggctgaaaattcagctttgcgcgccgtccacgcgtgacctccgacatttgattcgcttttgctgaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0690 Preprotein translocase subunit SecE ... can be seen here [K] COG0250 Transcription antiterminator ... can be seen here     ..................................................................................................................