                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:171 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCCGCTACGCGGAGCCTGAccggagcagagcggttcctgttttaacggaattgaatgctctattgcgaaacatccaatgccaa
tatggcaggcgcagccctcttatatcggggcagcgccttttttcttgccgaatcgataatgccggatttcgtgcagattgcagaagttcgtggatagttc
cattattttcggaattgctgatattagggaacaagaatggaacaaaattgcgaaatatatattaatcaatatgttatccctgttgccaaataagaacaaa
acagatacaaatagtTTG

    BMEI0787 Gene: BMEI0787     GI: 17987070     BI number: BMEI0787     GOG: COG0468     Description: RECA PROTEI   t a  a a  t cg cg gc ta        at a  g      t  a a  g      t  t c  |      c  c c  |       tg t  |       cg a  |       cg c  |       cg a  |       gc a  |      a  a a  |       cg gc        gc cg        cg gc        gc ta        gc tg        at             tttttcttgccgaatcgataatgccggatttcgtgcagattgcagaagttcgtggatagttccattattttcggaattgctgatattagggaacaagaatggaacaaaattgcgaaatatatattaatcaatatgttatccctgttgccaaataagaacaaaacagatacaaatagtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0468 RecA/RadA recombinase ... can be seen here     ..................................................................................................................