                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGGATCAGCCTTGGCTCTCGACCACCGGCTTCCTCGACAAGATCGACGAAAATCTT
CAGAAAGCCATGGCTGCCTGAttatagttctggcatttagccagtgtggaacccggcctttcgaggccgggtttttcattttccg
accaaaaagcatcctgttgtcgaaggcggcacactctaaaaaattgcggcctccttccggctttcacacgcctgcaatctccttttcgcataaaagcgcc
attcaggtttccggcatcacattttcctgccggagcgtatgataaggagagatatggATG

    BMEI0790 Gene: BMEI0790     GI: 17987073     BI number: BMEI0790     GOG: COG1785     Description: ALKALINE PHOSPHATAS             t           t  t           a  a            cg GA        gc T  t       gc C  t       ta C  a       cg Gt       t  t Ta       t  g Cg       g  t Gt       a  g G  t      t  g       tc T  c      a  a      t  g At       t  a       ta Cg       t  c       cg Cg       A  c       cg Gc       G  c       gc A  a      T  |       gc At        Cg        cg At        Cg        cg Gt        Gc        cg                         tttttcattttccgaccaaaaagcatcctgttgtcgaaggcggcacactctaaaaaattgcggcctccttccggctttcacacgcctgcaatctccttttcgcataaaagcgccattcaggtttccggcatcacattttcctgccggagcgtatgataaggagagatatggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1785 Alkaline phosphatase ... can be seen here     ..................................................................................................................