                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.80 kcal/mol
Anti-antiterminator:   Size=65 nt.     Delta G=-30.81 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATGGGAAAATGTGCTTCTCATATTTGCGGCAATGCTTCTGGTCGCGCCAGAAATCT
ATTCGTCTATCGTGGGTTTGATTCTGTTGCTGCCAGTCGTCGTTCGTCATCTGGTGGC
GTCGCGCCGGCCCGCCTACTGAacgggcttttcgggaaaggggacgcttaatctgccgcaattcggtaggcgatatcccgatgg
gcgcccctcttgcctgcacattgttttgtgcaggcgcgcgcgttttgccggacacatgcgggcatggaaccaacggggctcgccgccgttgttttccaga
GTG

    BMEI0798 Gene: BMEI0798     GI: 17987081     BI number: BMEI0798     GOG: NOG08828     Description: Hypothetical Protei gt t  t t  t at cg at cg gc ta cg cg gc t  | t  | c  | t  | c  | c  |       gg c  |      c  g cg        gc gc        ta cg        at gc        cg g  g      a  g gc       c  a tg       a  a at        gc gt        gc c  |      c  a c  |      c  a c  |       gc        tc t  |       tg       c  g a  |       tg        gc t  |       tg        gc at        tg       |  g gt        gc        gc cg       c  t       gc gc        gc        cg gc        cg        at                         tgttttccagaGTG     ..................................................................................................................