                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-10.74 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-13.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGCTTGGTACGGAAGTGGTTGTTCTGTAAaccgggaattcctgtatgggatcggccgggctcacgggcccggcct
tttcttttgcccaaccttcagaatgcggaaactgtggatttccagcttcgccatggaaatatgcgggcgcgggtattaagaggttggaatgtgttcgctc
cggggttttgctccggttttcctttgttcaatgacggttgccgctcaagctttggtgaaaaaatgccccgaagtgcatttttttgtggcggaatcaatcg
ggaaagtctaacgagataagcccATG

    BMEI0849 Gene: BMEI0849     GI: 17987132     BI number: BMEI0849     GOG: COG0504     Description: CTP SYNTHAS   c t  g t  c c  c                  t g  a                t  t at                 t  g cg        gt        gc cg       g  t       gt ta       a  g       gc ta       g  g       gc ta       a  a       cg at       a  a       cg g  a      t  t      t  t gt        tg       c  t tg        at       g  | gc        tg       c  | tg       g  t      t  | cg       g  t      t  | a  g       gc       g  | a  |       cg       t  | a  |       gc       g  | g  |      c  |      t  | gc        gt        at cg        gc        at gc        gc        gc tg        cg        gc                         tttgttcaatgacggttgccgctcaagctttggtgaaaaaatgccccgaagtgcatttttttgtggcggaatcaatcgggaaagtctaacgagataagcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0504 CTP synthase (UTP-ammonia lyase) ... can be seen here     ..................................................................................................................